|
Isolation of toxigenic Clostridium difficile from ready-to-eat salads by multiplex polymerase chain reaction in Isfahan, Iran
Mahire Yamoudy1, Maryam Mirlohi1, Bahram Nasr Isfahani2, Mohammad Jalali1, Zahra Esfandiari3, Nafiseh Sadat Hosseini2
1 Deparment of Food Science and Technology, Food Security Research Center, School of Nutrition and Food Sciences, Isfahan University of Medical Sciences, Isfahan, Iran
2 Deparment of Microbiology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran
3 Department of Research and Development, Deputy of Food and Drug, Isfahan University of Medical Sciences, Isfahan, Iran
| Date of Submission | 11-Mar-2014 |
| Date of Acceptance | 09-Aug-2014 |
| Date of Web Publication | 11-May-2015 |
Correspondence Address:
Maryam Mirlohi
Food Security Research Center, School of Nutrition and Food Sciences, Isfahan University of Medical Sciences, Isfahan
Iran
 Source of Support: None, Conflict of Interest: None  | Check |
DOI: 10.4103/2277-9175.156650
Background: Since 2003, the incidence of community associated Clostridium difficile infection (CA-CDI) has increased; different types of food have been supposed to be the vectors of C. difficile strains. The purpose of this study is to investigate the occurrence of C. difficile strains in ready-to-eat salads distributed in food services.
Materials and Methods: A total of 106 ready-made salad specimens were sampled from different restaurants and food services located in Isfahan, in the center of Iran. Positive isolates of C. difficile were identified and confirmed for the existence of three genes including tpi, tcdA and tcdB by multiplex PCR.
Results: A total of six (5.66%) samples were positive for C. difficile strains. Of which, one strain (16.6%) was positive for A and B toxins.
Conclusion: The existence of toxigenic C. difficile in ready-made salads could be a caution for public health. Further investigation is required to assess the relationship between the isolated strains in our study and those from diarrheic patients through molecular typing. Keywords: Clostridium difficile , multiplex PCR, prevalence, salad, vegetable
How to cite this article:
Yamoudy M, Mirlohi M, Isfahani BN, Jalali M, Esfandiari Z, Hosseini NS. Isolation of toxigenic Clostridium difficile from ready-to-eat salads by multiplex polymerase chain reaction in Isfahan, Iran. Adv Biomed Res 2015;4:87 |
How to cite this URL:
Yamoudy M, Mirlohi M, Isfahani BN, Jalali M, Esfandiari Z, Hosseini NS. Isolation of toxigenic Clostridium difficile from ready-to-eat salads by multiplex polymerase chain reaction in Isfahan, Iran. Adv Biomed Res [serial online] 2015 [cited 2023 Jun 8];4:87. Available from: https://www.advbiores.net/text.asp?2015/4/1/87/156650 |
| Introduction | |  |
0Clostridium difficile (C. difficile) is a Gram-positive, rod, sporogenic, anaerobic and toxin-producing bacteria. [1],[2] This organism is recognized as one of the causative agents of hospital infectious incidence. [3] About 15% to 25% of the episodes of antibiotic-associated diarrhea (AAD) is linked with the pathogenic strains; also, 86.1% of C. difficile isolates from the suspected cases of C. difficile-associated diarrhea (CDAD) were characterized as toxigenic. [4],[5] Pathogenic strains of C. difficile are capable of producing two enterogenic potential toxins including A (tcdA) and B (tcdB). [6] Toxin production leads to the spectrum of complications such as colitis, diarrhea, with or without the formation of a false membrane, toxic megacolon, perforation and even death. [7]
Recently another toxin known as C. difficile binary toxin (cdt) has been isolated from some certain strains. Of the total identified strains, 5% is known to have the capability of binary toxin production. Association between severe infectious form of disease in human with the latter toxin represents its particular importance. [8],[9]
A variety of niches including hospital environments, [10] soil, drinking water, untreated water, river, lake, marine environments and domestic food animals are introduced as the main source of C. difficle spores. [11],[12],[13] Accordingly, animal originated foods have been considered as one of the probable means of transmission. The prevalence of C. difficile have been reported in a variety of food types including: Different kinds of meat and meat products, [14],[15],[16],[17],[18] fish, shellfish, edible bivalve molluscs and other seafoods, [12],[19],[20] egg, [21] vegetables [22] and ready-to-eat salads. [23] Considering the genetic overlap of the food isolates and the clinical ones, the hypothesis that C. difficle could be a "food-borne pathogen" has been highly confirmed by the findings of the above-mentioned studies. [24]
Ready-to-eat salads are recognized as risky meals, prone to different kinds of contamination by food-borne bacteria like Escherichia Coli, Staphylococcus aureus, Bacillus cereus, Salmonella listeria spp (L. monocytogenes), Yersinia spp (Y. intermedia and Y innocua). [25],[26],[27],[28],[29] Such contaminations sometimes lead to outbreaks. [30] Rarely investigated, the prevalence of C. difficle was reported to be 2/4% to 7/5%, respectively in green vegetable and ready-to-eat salads in some countries. [21],[23] But there is no information on the incidence of C. difficile in these types of food items in Iran. In another point of view, as the main source of phytochemicals and fibers, fresh vegetables and salads are highly recommended in a daily diet by nutritionist. Present study deals with C. difficle contamination rate in ready-to-eat salads offered in the food services located in different districts of Isfahan.
| Materials and methods | | |
Ready-made salad specimens (n = 106) were sampled from 106 restaurants and food services in Isfahan using random sampling from April 9 th to July 1 st , 2013. Salads were composed of cabbage, lettuce, carrot, tomato, corn and pea. Samples were transferred under cool condition (portable insulated cold boxes) to food microbiology laboratory of Food Security Research Center in Isfahan University of Medical Sciences.
Isolation method was adapted from Rodriguez-Palacios et al.; [14] in brief, C. difficile broth; Clostridium difficile moxalactam norfloxacin (CDMN) containing: 40 g/l proteose peptone, 5 g/l disodium hydrogen phosphate, 0.1 g/l magnesium sulfate, 2 g/l sodium chloride, 6 g/l fructose, 1 g/l sodium taurocholate was supplemented with 500 mg/l cysteine hydrochloride, 32 mg/l moxalactam, and 12 mg/l norfloxacin.
The sample was homogenized under aseptic conditions. Twenty grams of each sample was cultured into 30 ml of CDMN broth and incubated under anaerobic condition at 37°C for 10-15 days.
Spore selection by alcohol shock was performed by adding 2 ml of the cultured broth to 2 ml of 96% ethanol (1:1 [v/v]), then thoroughly homogenized by a vortex mixer (VELP Scientific, Italy) and incubated for 50 min at room temperature. The mixture was then centrifuged (BH 1200, IRAN) at 3800× g for 10 min and the sediment was streaked onto CDMN Agar (RM026-500G, Himedia, India) added with 5% horse blood and incubated in an anaerobic chamber (5% H 2 , l0% CO 2 , 85% N 2 ) at 37°C (MART microbiology B.V, Drachten, the Netherlands). Up to two suspected colonies with the morphology characteristics such as grayish, swarming, rough, non-hemolytic and horse-like smell were considered presumably positive and sub-cultured on anaerobic blood agar (Merck, Germany). C. difficile was presumptively identified with Gram-stain appearance, Sub-terminal, green-stained endospores, ovoid-shape, vegetative, pink-stained cells and and being positive for l-proline aminopeptidase reaction (Pro Disc, Remel, Lenexa, KS, USA). [31]
DNA extraction was performed using a commercial kit (DNP TM kit, CinnaGen Inc, Iran). In brief, bacterial culture was centrifuged (BH 1200, IRAN) for 10 minutes at 7500g. Bacterial culture (10-20 mg) was collected in a 1.5 ml microcentrifuge tube and suspended in 100 μl of protease buffer. Five μl of protease was added to suspension, mixed and kept at 55°C for 30 minutes. One hundred of the prepared mixture was blended with 400 μl of lysis solution and vortexed (VELP Scientific, Italy) for 15-20 seconds. Precipitation solution (300 μl) was added to the prepared mixture, mixed for 5 s and centrifuged 12,000g for 10 minutes. The tube containing the obtained solution was decanted by gentle inverting on a tissue paper for 2-3 seconds Wash buffer (1 ml) was added to the tube, mixed by 3-5 s. and centrifuged at 12,000g for 5 min, then it was decanted. The precipitate was dried at 65°C for 5 min and suspended in 50 μl of solvent buffer by gentle shaking and kept at 65°C for 5 minutes. Insoluble particles were precipitated by centrifugation at 12,000g for 30 s and purified DNA was obtained from supernatant. The concentration of DNA was measured visually through electrophoresis in fresh 2% agarose gel. One μl of DNA solution was used for each 50 μl of PCR mixture.
Multiplex PCR was applied as described by Lemee et al. [32] Three pairs of primer were used containing tpi - specific primers (tpi - F [5' AAAGAAGCTACTAAGGGTACAAA - 3'] and tpi - R [5' - CATAATATTGGGTCTATTCCTAC - 3']), tcdA - specific primers (tcdA - F [5' - AGATTCCTATATTTACATGACAATAT - 3'] and tcdA - R [5' GTATCAGGCATAAAGTAATATACTTT - 3']) and tcdB - specific primers (tcdB - F [5' GGAAAAGAGAATGGTTTTATTAA - 3'] and tcdB - R [5' ATCTTTAGTTATAACTTTGACATCTTT - 3']). First primers were inferred from alignments of internal fragments of the tpi gene that (as housekeeping gene) was used to distinguish Clostridium species and it produced a 230 bp amplified fragment specific for C. difficile. The tcdB - specific primers were deduced from the conserved 5' region of tcdB and produced a 160 bp fragment. The tcdA - specific primers were designed to flank the smallest of the three deletions in the 3' region of tcdA and produced a 369 - bp fragment for A + B + strains and a 110 - bp fragment for A-B+ strains.
The PCR was set for 25 μl reaction volume containing 10% (v/v) glycerol, 1 μM each primer, 200 μM each deoxynucleoside triphosphate, 0.5 U of Taq DNA polymerase in a 1X amplification buffer (10 mM Tris-HCl [pH 8.3], 50 mM KCl, 2.5 mM MgCl 2 ) aztd and 1-5 μl of each template DNA. The reaction was performed in the GeneAmp System 2400 thermal cycler.
The PCR mixtures were denatured at 95°C for 3 min in the beginning, then a touchdown procedure was executed at 95°C for 30 s, annealing for 30 s at temperatures decreasing from 65 to 55°C during the first 11 cycles (with 1°C steps in cycles 1 to 11). At the end, a final extension step at 72°C for 30 s was performed. Totally, 40 cycles were carried out. Kindly provided by the University of Guelph, C. difficile ribotype 027 was used as a positive control.
PCR products were analyzed on 2% agarose (progen, Australia) gel by electrophoresis and after staining the gel with DNA green viewer was visualized under UV light.
| Result | | |
The result of the present study revealed that the incidence rate of C. difficle in the tested ready-to-made salads was about 6% and toxic-producing strains were found among the isolates. Of which, one strain (16.6%) was positive for A and B toxins. None of the other identified strains showed toxin-producing property.
The results of electrophoresis of the PCR products were depicted in [Figure 1]. Generating a 230-bp fragment, all of the isolates were shown to carry the tpi gene, but only one of the six isolated strains were positive for tcdA and tcdB genes by producing a 369-bp fragment and a 160-bp fragment as their PCR products, respectively. | Figure 1: Agarose gel electrophoresis pattern shows multiplex PCR amplification products. Lane 1: Control strain that is positive for tpi, tcdA and tcdB genes, Lane 2,3,5,6,7: Isolates of C. difficile, lane 4: toxigenic (A+B+) C. difficile strain, lane 8: 100 bp DNA ladder
Click here to view |
| Discussion | | |
These results are in accordance with the results of the study carried out by Bakri et al. [23] in Scotland where C. difficile spores were isolated from 7.5% (3/40) of tested salad samples composed of baby leaf spinach, organic mixed leaf salad and organic lettuce. Two of the identified isolates were found to be toxigenic and characterized as A-B + and A + B+ [23] . In a recent study performed by Eckert et al. in examining 60 ready-to-made salads and 44 vegetable samples, the prevalence rate of C. difficile was revealed to be in 3.3% and 2.27%, respectively. [33] Likewise, Al Saif and Brazier reported on the contamination rate of 2.4% for the raw vegetable marketed in Cardiff area of south Wales. In their study, C. difficile strains were detected from potato, onion, mushroom, carrot, radish and cucumber samples. About two third of the identified isolates in the latter study were capable of A toxin production. [34] However, in another study, C. difficile was not detected in any of the examined ready-to-made salads and sprouts samples in Slovenia. The absence of C. difficle strains in the latter study might be affected by its little sample size (n = 8) [21] .
It was also shown in another study in Canada that the contamination rate of vegetables to C. difficle was 4.5% (5/111). Toxin-producing strains with the capability of Aand B toxin production were found among the detected isolates. [22]
Providing important vitamins and minerals as well as a wide range of health-promoting secondary metabolites, vegetables are important components of a healthy diet. Regular daily consumption of vegetables in sufficient amounts can prevent some diseases. In recent years, ready-to-made salads, prepared from raw vegetables have become one of the inseparable components of Iranian food tables in the restaurants. Salads and fresh vegetables are usually considered as the food items with high potentials for several microbial contaminations. The occurrence of C. difficle in ready-to-made salads has been investigated in few studies in different countries. [21.23],[33] Although history of antibiotic treatments, age (over 65) and hospitalization were known to be the main risk factors for C. difficile infection (CDI). [3] Recent studies have demonstrated that the individuals without any of the given risk factors are still susceptible to infection by C. difficle strains. [35] Considering the high nutritional value of a vegetable meal as a ready-to-made salad, evaluation of its microbial quality is far important.
It seems that the prevalence of C. difficle among the salads and vegetable samples in all similar works is very close and ranged from 0% to 7.5%, noticeably lower than that reported about other food sources. A prevalence rate of 42% was previously shown for meat and seafoods. [15],[16],[17],[18],[19],[20]
Iranian clinical studies demonstrated that C. difficile strains isolated from hospitalized diarrheic patients at the incidence rate of 6% to 22.2% [36],[37],[38],[39],[40] with 078 and 014 ribotypes as the most prevalent strains. These ribotypes were reported to be isolated from salad and fresh vegetable samples in other studies. [23],[34]
To examine the relationship between the isolated strains in our study and those ones obtained from diarrheic patients, molecular typing studies are required.
| Acknowledgments | | |
The authors appreciate the environmental health aministration of Isfahn for their collaboration. Furthermore, Dr. Parisa Shoaei's corporation is kindly appreciated.
| References | | |
| 1. | McFee RB, Abdelsayed GG. Clostridium difficile. Dis Mon 2009;55:439-70.  |
| 2. | Kuijper E, Coignard B, Tüll P. Emergence of Clostridium difficile‐associated disease in North America and Europe. Clin Microbiol Infec 2006;12(Suppl 6):2-18.
|
| 3. | Rupnik M. Is Clostridium difficile-associated infection a potentially zoonotic and foodborne disease? Clin Microbiol Infect 2007;13:457-9. |
| 4. | Hull MW, Beck PL. Clostridium difficile-associated colitis. Can Fam Physician 2004;50:1536-40, 1543-5. |
| 5. | Barbut F, Mastrantonio P, Delmee M, Braziar J, Kuijper E, Poxton I. Clin Microbiol Infec 2007;13:1048-57. |
| 6. | Sunenshine RH, McDonald LC. Clostridium difficile-associated disease: New challenges from an established pathogen. Clev Clin J Med 2006;73:187-97. |
| 7. | Geric B, Johnson S, Gerding DN, Grabnar M, Rupnik M. Frequency of binary toxin genes among Clostridium difficile strains that do not produce large clostridial toxins. J Clin Microbiol 2003;41:5227-32. |
| 8. | Songer JG. Clostridia as agents of zoonotic disease. Vet Microbiol 2010;140:399-404. |
| 9. | McEllistrem MC, Carman RJ, Gerding DN, Genheimer CW, Zheng L. A hospital outbreak of Clostridium difficile disease associated with isolates carrying binary toxin genes. Clin Infect Dis 2005;40:265-72. |
| 10. | Martirosian G. Recovery of Clostridium difficile from hospital environments. J Clin Microbiol 2006;44:1202-3. |
| 11. | Simango C. Prevalence of Clostridium difficile in the environment in a rural community in Zimbabwe. Trans R Soc Trop Med Hyg 2006;100:1146-50. |
| 12. | Pasquale V, Romano VJ, Rupnik M, Dumontet S, Cižnár I, Aliberti F, et al. Isolation and characterization of Clostridium difficile from shellfish and marine environments. Folia Microbiol 2011;56:431-7. |
| 13. | Pirs T, Ocepek M, Rupnik M. Isolation of Clostridium difficile from food animals in Slovenia. J Med MicrobiL 2008;57:790-2. |
| 14. | Rodriguez-Palacios A, Staempfli HR, Duffield T, Weese JS. Clostridium difficile in retail ground meat, Canada. Emerg infect dis 2007;13:485-7. |
| 15. | Songer JG, Trinh HT, Killgore GE, Thompson AD, McDonald LC, Limbago BM. Clostridium difficile in retail meat products, USA, 2007. Emerg Infect Dis 2009;15:819-21. |
| 16. | Esfandiari Z, Jalali M, Ezzatpanah H, Weese JS, Chamani M. The Frequency of Clostridium difficile in processing steps of hamburger. J HSR 2013; 1460-8. |
| 17. | Rahimi E, Jalali M, Weese JS. Prevalence of Clostridium difficile in raw beef, cow, sheep, goat, camel and buffalo meat in Iran. BMC Public Health 2014;14:119. |
| 18. | Esfandiari Z, Jalali M, Ezzatpanah H, Weese JS, Chamani M. Prevalence and characterization of Clostridium difficile in beef and mutton meats of Isfahan region, Iran. Jundishapur J Microbiol 2014;7:e16771. |
| 19. | Metcalf D, Avery BP, Janecko N, Matic N, Reid-Smith R, Weese JS. Clostridium difficile in seafood and fish. Anaerobe 2011;17:85-6. |
| 20. | Pasquale V, Romano V, Rupnik M, Capuano F, Bove D, Aliberti F, et al. Occurrence of toxigenic Clostridium difficile in edible bivalve molluscs. Food Microbiol 2012;31:309-12. |
| 21. | Zidaric, V, Rupnik M. Clostridium difficile in meat products, eggs and vegetables in Slovenia. In 4 th International Clostridium difficile Symposium, 20-22 September, 2012, Bled, Slovenia, abstract: Poster 118. |
| 22. | Metcalf DS, Costa MC, Dew WM, Weese JS. Clostridium difficile in vegetables, Canada. Lett Appl Microbiol 2010;51:600-2. |
| 23. | Bakri MM, Brown DJ, Butcher JP, Sutherland AD. Clostridium difficile in ready-to-eat salads, Scotland. Emerg Infect Dis 2009;15:817-8. |
| 24. | Gould LH, Limbago B. Clostridium difficile in food and domestic animals: A new foodborne pathogen? Clin Infect Dis 2010;51:577-82. |
| 25. | Delaquis P, Bach S, Dinu LD. Behavior of Escherichia coli O157: H7 in leafy vegetables. J Food Prot 2007;70:1966-74. |
| 26. | Meldrum R, Little C, Sagoo S, Mithani V, McLauchlin J, de Pinna E. Assessment of the microbiological safety of salad vegetables and sauces from kebab take-away restaurants in the United Kingdom. Food Microbiol 2009;26:573-7. |
| 27. | Sagoo SK, Little CL, Ward L, Gillespie IA, Mitchell RT. Microbiological study of ready-to-eat salad vegetables from retail establishments uncovers a national outbreak of salmonellosis. J Food Prot 2003;66:403-9. |
| 28. | Pingulkar K, Kamat A, Bongirwar D. Microbiological quality of fresh leafy vegetables, salad components and ready-to-eat salads: An evidence of inhibition of Listeria monocytogenes in tomatoes. Int J food Sci and Nutr 2001;52:15-23. |
| 29. | Sagoo SK, Little CL, Mitchell RT. The microbiological examination of ready-to-eat organic vegetables from retail establishments in the United Kingdom. Lett Appl Microbiol 2001;33:434-9. |
| 30. | MercanogluTaban B, Halkman AK. Do leafy green vegetables and their ready-to-eat [RTE] salads carry a risk of foodborne pathogens? Anaerobe 2011;17:286-7. |
| 31. | on Fedorko DP, Williams EC. Use of cycloserine-cefoxitin-fructose agar and L-proline-aminopeptidase (PRO Discs) in the rapid identification of Clostridium difficile. J Clin Microbiol 1997;35:1258-9. |
| 32. | Lemee L, Dhalluin A, Testelin S, Mattrat MA, Maillard K, Lemeland JF, et al. Multiplex PCR targeting tpi (triose phosphate isomerase), tcdA (Toxin A), and tcdB (Toxin B) genes for toxigenic culture of Clostridium difficile. J Clin Microbiol 2004;42:5710-4. |
| 33. | Eckert C, Burghoffer B, Barbut F. Contamination of ready-to-eat raw vegetables with Clostridium difficile, France. J Med Microbiol 2013;62:1435-8. |
| 34. | Centers for Disease Control and Prevention (CDC). Severe Clostridium difficile-associated disease in populations previously at low risk - four states, 2005. MMWR Morb Mortal Wkly Rep 2005;54:1201-5. |
| 35. | al Saif N, Brazier JS. The distribution of Clostridium difficile in the environment of South Wales. J Med Microbiol 1996;45:133-7. |
| 36. | Sadeghifard N, Salari MH, Ghassemi MR, Eshraghi S, Amin Harati F. The Incidence of nosocomial toxigenic Clostridium difficile associated diarrhea in Tehran tertiary medical centers. Acta Med Iran 2010;48:320-5. |
| 37. | Salari MH, Badami N, Sadeghifard N, Amin Harati F. Investigation of various tissue culture monolayers sensitivity in detection of Clostridium difficile toxin. Iran J Public Health 2008;37:99-102. |
| 38. | Sadeghifard N, Salari M, Ghassemi M, Shirazi M, Feizabadi M, Kazemi B, et al. Prevalence of Clostridium difficile-associated diarrhea in hospitalized patients with nosocomial diarrhea. Iran J Public Health 2005;34:67-72. |
| 39. | Nasri M, Khorvash F, Zolfaghari M, Mobasherizadeh S. The Relative Frequency of Clostridium difficile in Fecal Samples of Hospitalized Patients with Diarrhea by ELISA Method. Journal of Isfahan Medical School 2012;29:2376-82. |
| 40. | Jalali M, Khorvash F, Warriner K, Weese JS. Clostridium difficile infection in an Iranian hospital. BMC Res Notes 2012;5:159. |
[Figure 1]
| This article has been cited by | | 1 |
Global prevalence of Clostridioides difficile in 17,148 food samples from 2009 to 2019: a systematic review and meta-analysis |
|
| Soroush Borji, Sepide Kadivarian, Shirin Dashtbin, Sara Kooti, Ramin Abiri, Hamid Motamedi, Jale Moradi, Mosayeb Rostamian, Amirhooshang Alvandi | | Journal of Health, Population and Nutrition. 2023; 42(1) | | [Pubmed] | [DOI] | | | 2 |
Clostridioides difficile epidemiology in the Middle and the Far East |
|
| Marie Brajerova, Jaroslava Zikova, Marcela Krutova | | Anaerobe. 2022; : 102542 | | [Pubmed] | [DOI] | | | 3 |
Detection and Genomic Characterisation of Clostridioides difficile from Spinach Fields |
|
| Pilar Marcos, Paul Whyte, Catherine Burgess, Daniel Ekhlas, Declan Bolton | | Pathogens. 2022; 11(11): 1310 | | [Pubmed] | [DOI] | | | 4 |
Clostridioides difficile in Non-hospital Sources (Animals, Food, and Environment) in Asian Countries: A Literature Review |
|
| Zahra Esfandiari,Fatemeh Amani,Shokofeh Khavari,Masoud Sami | | Jundishapur Journal of Microbiology. 2021; 14(3) | | [Pubmed] | [DOI] | | | 5 |
Methods currently applied to study the prevalence of Clostridioides difficile in foods |
|
| Joana Barbosa,Ana Campos,Paula Teixeira | | AIMS Agriculture and Food. 2020; 5(1): 102 | | [Pubmed] | [DOI] | | | 6 |
Prevalence of Clostridium difficile contamination in Iranian foods and animals: A systematic review and meta-analysis |
|
| Meysam Hasannejad-Bibalan,Arshid Yousefi Avarvand,Yalda Malekzadegan,Hoda Sabati,Mohammad Esmaeil Amini,Hadi Sedigh Ebrahim-Saraie | | Gene Reports. 2020; : 100898 | | [Pubmed] | [DOI] | | | 7 |
Global and Historical Distribution of Clostridioides difficile in the Human Diet (1981–2019): Systematic Review and Meta-Analysis of 21886 Samples Reveal Sources of Heterogeneity, High-Risk Foods, and Unexpected Higher Prevalence Toward the Tropic |
|
| Alexander Rodriguez-Palacios,Kevin Q. Mo,Bhavan U. Shah,Joan Msuya,Nina Bijedic,Abhishek Deshpande,Sanja Ilic | | Frontiers in Medicine. 2020; 7 | | [Pubmed] | [DOI] | | | 8 |
Genomic Delineation of Zoonotic Origins of Clostridium difficile |
|
| Daniel R. Knight,Thomas V. Riley | | Frontiers in Public Health. 2019; 7 | | [Pubmed] | [DOI] | | | 9 |
Molecular typing of Clostridium difficile isolates cultured from patient stool samples and gastroenterological medical devices in a single Iranian hospital |
|
| Masoumeh Azimirad,Marcela Krutova,Otakar Nyc,Zahra Hasani,Leili Afrisham,Masoud Alebouyeh,Mohammad Reza Zali | | Anaerobe. 2017; 47: 125 | | [Pubmed] | [DOI] | | | 10 |
Dissemination of Clostridium difficile
in food and the environment: Significant sources of C. difficile
community-acquired infection? |
|
| K. Warriner,C. Xu,M. Habash,S. Sultan,S.J. Weese | | Journal of Applied Microbiology. 2016; | | [Pubmed] | [DOI] | |
|
 |
|
|
|
Search Pubmed for