Users Online: 759
Home Print this page Email this page
Home About us Editorial board Search Browse articles Submit article Ahead of Print Instructions Subscribe Contacts Login 


 
Previous article Browse articles Next article 
ORIGINAL ARTICLE
Adv Biomed Res 2018,  7:96

Pharmacogenomics of Sulfonylureas Response in Relation to rs7754840 Polymorphisms in Cyclin-Dependent Kinase 5 Regulatory Subunit-associated Protein 1-like (CDKAL1) Gene in Iranian Type 2 Diabetes Patients


1 Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Tehran, Iran
2 Iranian Blood Transfusion Organization Research Centre, Tehran, Iran
3 Isfahan Endocrine and Metabolism Research Center, Isfahan University of Medical Sciences, Isfahan, Iran

Date of Web Publication25-Jun-2018

Correspondence Address:
Prof. Rasoul Salehi
Department of Genetics and Molecular Biology, School of Medicine, Isfahan University of Medical Sciences, Isfahan
Iran
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/abr.abr_144_17

Rights and Permissions
  Abstract 


Background: Sulfonylureas are important drugs of choice for treatment of type 2 diabetes mellitus (T2DM). It is suggested that differential response to sulfonylureas from T2DM patients is under influence of single nucleotide polymorphisms in some of the target genes. In spite of favorable therapeutic effects, sulfonylureas are associated with some adverse side effects such as microvascular complications and stroke, especially in older patients. Therefore, for T2DM patients who are getting less benefit, sulfonylureas should be avoided. Cyclin-dependent kinase 5 regulatory subunit-associated protein 1-like (CDKAL1) gene variation is reported to be associated with sulfonylureas effectiveness. Due to the inconsistency of available data regarding association of rs7754840 in CDKAL1 gene with sulfonylureas response in T2DM patients, the present study is conducted. Materials and Methods: Fifty-one diabetic patients sensitive to sulfonylureas and 51 patients resistant to sulfonylureas treatment were recruited to this study. After extraction of DNA from patients' peripheral blood samples, rs7754840 single-nucleotide polymorphism was genotyped by polymerase chain reaction-restriction fragment length polymorphism assay using MaeII (Tail) restriction enzyme. Results: Frequency of G allele in resistant group was more than sensitive group (71, 6% vs. 57, 8%). Regression analysis was shown significant association between GG genotype and higher risk of resistance to sulfonylureas treatment (odds ratio = 2.250 [95% confidential intervals: 1.010–5.012]; P = 0.046). Conclusion: Our data confirmed that genotypes of rs7754840 are significantly associated with sulfonylureas treatment response. rs7754840 in CDKAL1 gene in combination with other clinicopathological findings would help to move towards personalized therapy of T2DM patients.

Keywords: Cyclin-dependent kinase 5 regulatory subunit-associated protein 1-like, glycemic control, single nucleotide polymorphism, sulfonylureas, type 2 diabetes


How to cite this article:
Soltani G, Hatefi Z, Salehi AR, Khosravi S, Rahimi Ghiasi M, Teke K, Aminorroaya A, Salehi R. Pharmacogenomics of Sulfonylureas Response in Relation to rs7754840 Polymorphisms in Cyclin-Dependent Kinase 5 Regulatory Subunit-associated Protein 1-like (CDKAL1) Gene in Iranian Type 2 Diabetes Patients. Adv Biomed Res 2018;7:96

How to cite this URL:
Soltani G, Hatefi Z, Salehi AR, Khosravi S, Rahimi Ghiasi M, Teke K, Aminorroaya A, Salehi R. Pharmacogenomics of Sulfonylureas Response in Relation to rs7754840 Polymorphisms in Cyclin-Dependent Kinase 5 Regulatory Subunit-associated Protein 1-like (CDKAL1) Gene in Iranian Type 2 Diabetes Patients. Adv Biomed Res [serial online] 2018 [cited 2018 Dec 10];7:96. Available from: http://www.advbiores.net/text.asp?2018/7/1/96/234998




  Introduction Top


Type 2 diabetes mellitus (T2DM) is a multifactorial disease that results from the interaction of genetic and environmental factors.[1] Hyperglycemia, the hallmark of T2DM, accompanying with impaired metabolism of proteins and fats, is due to the defective insulin action or insulin secretion.[2] Hyperinsulinemia, beta-cell dysfunction, and insulin resistance are the pathophysiological determinants of dysglycemia and type 2 diabetes.[3] Genetics play a significant role in susceptibility to diabetes and association of >40 genes with T2DM has been proved by genome-wide association (GWA) studies.[4] Lifestyle changes and metformin monotherapy are usually considered for T2DM patients as therapeutic steps. Sulfonylureas are prescribed as second-line therapy during the progression of disease or failure of getting satisfactory effects with metformin alone.[5],[6] Sulfonylureas induce secretion of insulin in pancreatic beta-cells by attachment to the sulfonylurea receptors 1 subunit of ATP-sensitive potassium (KATP) channel. This interaction makes KATP channel closed leading to prevent the outflow of potassium. It induces calcium channel opening and elevation of intracellular calcium which in turn results in insulin secretion from the beta cells.[7],[8] Although sulfonylureas are common affordable options for treatment of type 2 diabetes,[9] there are some concerns about several reported adverse side effects such as weight gain, increased cardiovascular complications, risk of stroke, and hypoglycemia.[10],[11],[12]

Substantial interindividual differences are shown in glucose-lowering effect of sulfonylureas.[13] Cyclin-dependent kinase 5 (CDK5) regulatory subunit- associated protein 1-like (CDKAL1) is one of the genes whose strong association with T2DM has been reported in several GWA studies.[14],[15],[16],[17],[18] CDKAL1 gene in 6p22.3 produces a 65 KDa protein with unknown function that is similar to CDK regulatory subunit-associated protein 1 (CDK5RAP-1) expressing in pancreatic beta-cells. CDK5RAP1 protein inhibits CDK5 activity by binding to P35 and activator of CDK5. CDK5 inhibits insulin secretion in response to glucose and decreased insulin gene expression, so it is associated with the pancreatic beta-cell malfunction and susceptibility to T2DM. CDKAL1 plays a role in beta-cell function through inhibition of CDK5.[19],[20],[21],[22] Carrying risk variants of CDKAL1 may attenuate normal functioning of CDKAL1 resulting in impaired insulin secretion.[16],[23] Many studies have shown that rs7754840 in CDKAL1 gene is associated with risk of type 2 diabetes.[24] CC homozygotes rs7754840 was related to decreased insulin secretion in the first phase and not in the second phase during the hyperglycemia clamps and glucose tolerance tests.[25],[26] Furthermore, the relationship between this single-nucleotide polymorphism (SNP) and defects in insulin secretion and processing are reported.[26],[27],[28] A replication study showed that the C allele and CC genotype of rs7754840 were associated with increased risk of T2DM in Iranian population.[29] Gene variants in CDKAL1 were also reported to be associated with sulfonylureas treatment outcome in T2DM patients.[13],[30],[31] Association of SNP rs7754840 in CDKAL1 gene with sulfonylurea treatment effect is not yet determined in Iranian population. Therefore, the aim of this pharmacogenetic study was to evaluate relationship of rs7754840 genotypes in CDKAL1 gene with sulfonylureas treatment in T2DM patients sensitive and resistant to this drug.


  Materials and Methods Top


Diabetic patients selected on the basis of the World Health Organization criteria (fasting plasma glucose 0.7 mmol/l and/or 2 h plasma glucose >11.1). Totally, 102 T2DM patients were recruited to this study (51 sensitive and 51 resistant diabetic patients to treatment with sulfonylureas). Resistant T2DM patients were selected on the basis of having combined therapy of metformin and sulfonylurea for 12 months, but their HbA1c failed to maintain <7.0%. Sensitive patients were selected among those who have maintained HbA1c<7.0% during 12 months combined therapy. Patients who started insulin therapy were excluded from the study. Informed consent signed by all participants based on a standard questionnaire was approved by the Ethics Committee of the Isfahan University of Medical Sciences. Anthropometric characteristics of the participants were collected through a structured questionnaire.

Genotyping of single-nucleotide polymorphism rs7754840 (C/G) polymorphism

Peripheral blood samples collected from participants' genomic DNA were extracted from blood samples by Genetbio DNA extraction kit (Korea) according to the manufacturer's instructions. Genotyping was determined by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay. PCR was performed by CDKAL1-specific primers: forward TCTTGGAGTAGTCACCTGGTCA and reverse AAAAATCCTCGCAACAACAGA. PCR thermal cycling and durations of PCR cycles were as follows: initial denaturation at 95°C for 6 min, followed by 34 cycles at 94°C, 58°C, and 72°C all for 50 s. A final extension of 5 min was applied after the completion of all 34 cycles and hold at 4°C. Subsequently, products of PCR were digested by MaeII (Tail) restriction enzyme for 12 h at 65°C and analyzed on 2% agarose. After digestion, the presence of two bands of 495 bp and 286 bp was indicative of CC genotype, but a single band of 781 bp represented GG genotype. In heterozygote genotypes (GC), three bands of 495 bp, 286 bp, and 781 bp became visible on the gel. Confirmation of RFLP-based genotyping was done by direct sequencing of some 10% of randomly selected samples.

Statistical analyses were accomplished by SPSS for windows software (Version 22.0; SPSS, Chicago IL, USA). Chi-square test was used to evaluate allele and genotype frequencies for Hardy–Weinberg equilibrium. For calculation of distributions and risk allele/genotype-specific odds ratios (OR) (OR, 95% confidential intervals [CI]) and analogous P values after adjustment for gender, age, and body mass index (BMI) as covariates, logistic regression analyses were performed. Continuous variables were introduced as mean ± standard deviation and compared between sensitive and resistant groups using independent student's t-test.


  Results Top


Clinical and biochemical characteristics of the participants

Baseline clinical and biochemical characteristics of the patients are displayed in [Table 1]. The mean age and BMI level were 57.21 ± 9.92 years and 25.79 ± 3.19 kg/m2 for the sensitive patients and 55.68 ± 9.06 years and 25.63 ± 3.70 kg/m2 for the resistant patients, respectively. No significant differences were shown in age and BMI among the two groups. Mean changes of HbA1c in sensitive and resistant patients, 4 times every 3 months during the test period of 12 months, are shown in [Table 1].
Table 1: Demographic characteristics of type 2 diabetes mellitus patients with different sulfonylureas treatment response

Click here to view


Association of rs7754840 polymorphism with drug response in type 2 diabetes mellitus patients

Genotype and allele frequencies of the sensitive and resistant diabetic patients are shown in [Table 2]. Frequencies of the CC, GG, and GC genotypes of rs7754840 were 17.6, 33.3, and 49.0% in sensitive group and 9.8, 52.9, and 37.3% in resistant group, respectively. Between these three genotypes of the rs7754840 in CDKAL1 gene, GG was found meaningfully associated with increased risk of resistance phenotype to sulfonylureas (OR = 2.250 [95% CI: 1.010–5.012]; P = 0.046). The frequency of G allele in resistant patients (71.6%) was more than sensitive patient group (57.8%); therefore, this allele would be risk allele for conferring resistance to sulfonylureas (OR = 1.835 (95% CI: 1.024–3.286); P = 0.040). Compared with the GG genotype (as resistance genotype), CC + GC genotypes determined to be associated with sensitive phenotype and more responsive to sulfonylureas treatment.
Table 2: Allele and genotype distribution of rs7754840 single-nucleotide polymorphism in type 2 diabetes mellitus patients with sensitive and resistant response toward sulfonylureas treatment

Click here to view



  Discussion Top


Diabetes is a disease that if not diagnosed early, not treated quickly, and properly managed, becomes serious health disaster.[1] The importance of good glycemic control in the prevention of microvascular complications of diabetes is generally accepted.[2],[32],[33] Differences in response to sulfonylureas in diabetic patients make a flaw in management of diabetes complications. Therefore, early identification of T2DM patients for whom sulfonylureas are less beneficial and likely experience adverse events would much help in patients managements.[34],[35] Patients who are not getting benefit from sulfonylureas consumption may unnecessary exposed to unfavorable side effects of the drug such as increased risk of cardiovascular disease, stroke, and weight gain without ideal glycemia control.[9],[36],[37],[38],[39]

Here, we showed that carriers of G allele and GG genotypes of the rs7754840 SNP in CDKAL1 gene have an increased risk of resistant phenotype to sulfonylureas treatment compared with GC + CC genotypes. To the best of our knowledge, this is the first study in Iranian population that provides association between genotypes of rs7754840 SNP and sulfonylureas treatment outcome in T2DM patients.

In mice lacking the CDKAL1 gene, the decline in first-phase insulin secretion and defects in mitochondrial ATP production has been observed.[19] CDKAL1 by facilitating the production of mitochondrial ATP would make KATP channel to be active as well as an increase in intracellular calcium by activating calcium channels that are consequently lead to insulin exocytosis.[40] This function of CDKAL1 can explain the relationship between gene variants of CDKAL1 and response to sulfonylureas.[13],[30] Associations of some variants of CDKAL1 gene with therapeutic response to sulfonylureas are reported in some studies. In Caucasians, the study of rs7756992 polymorphism of CDKAL1 gene reported a prominent higher reduction in HbA1c at 6 months in heterozygotes and homozygotes of the risk allele A carriers.[13] Haplogenotypes of CDKAL1 that have the risk of T2DM were associated with decreased response to nonsulfonylureas and sulfonylureas agonists of pancreatic KATP channel in Russian population. According to this study, in sulfonylureas consumers, internal circulating insulin in postprandial period was much better in C allele carrier of three SNPs of CDKAL1 g ene (allele C of rs10946398, allele C of rs7754840, and allele G of rs7756992).[30] In rs10811661 polymorphism in the CDKN2A/ 2B gene, which also has similar function as CDKAL1, CC risk allele homozygotes showed significant reductions in free plasma glucose in response to sulfonylureas.[31] Inconsistent with our study, in two studies of Japanese and Chinese population, no significant differences were observed in response to sulfonylureas between genotypes of rs7754840 of CDKAL1.[41],[42] This inconsistency is probably because of the genetic differences in various populations.

Our study is different with other similar studies [13],[30],[31],[41],[42] in the way that we genotyped two distinguished groups of sensitive and resistant patients for sulfonylureas treatment that were homogenous in number, age, and BMI. Furthermore, all of the T2DM patients recruited to this study started their drug therapy with metformin monotherapy and later due to the failure of metformin to manage acceptable glycaemia level switched to a drug from sulfonylureas family. Patients were divided into sensitive and resistant groups, based on changes in the HbA1c over a period of 12-month therapy during which every 3 months laboratory data were collected.


  Conclusion Top


Our study proved that GG genotype of the SNP rs7754840 is associated with high risk of sulfonylureas-resistance phenotype compared to CC + GC genotypes in Iranian population. Studies of this sort would facilitate to find a cohort of suitable biomarkers for drug efficiency evaluation in T2DM patients. Personalized prescription of glycaemia control drugs would make diabetes management more successful. Prior genetic testing using suitable biomarkers make personalized prescription possible. Right drug administration means less unfavorable side effects and fast glycemic control and therefore preventing hyperglycemia-related complications in T2DM patients.

Financial support and sponsorship

This study was supported by a research grant, No 394374, from Vice-chancellery for research, Isfahan University of Medical Science, IR Iran.

Conflicts of interest

There are no conflicts of interest.



 
  References Top

1.
Kong AP, Luk AO, Chan JC. Detecting people at high risk of type 2 diabetes- how do we find them and who should be treated? Best Pract Res Clin Endocrinol Metab 2016;30:345-55.  Back to cited text no. 1
[PUBMED]    
2.
Bain SC, Feher M, Russell-Jones D, Khunti K. Management of type 2 diabetes: The current situation and key opportunities to improve care in the UK. Diabetes Obes Metab 2016;18:1157-66.  Back to cited text no. 2
    
3.
Yang Y, Wang Y, Zhou K, Hong A. Constructing regulatory networks to identify biomarkers for insulin resistance. Gene 2014;539:68-74.  Back to cited text no. 3
[PUBMED]    
4.
Wheeler E, Barroso I. Genome-wide association studies and type 2 diabetes. Brief Funct Genomics 2011;10:52-60.  Back to cited text no. 4
[PUBMED]    
5.
Ashcroft FM, Rorsman P. Diabetes mellitus and the β cell: The last ten years. Cell 2012;148:1160-71.  Back to cited text no. 5
[PUBMED]    
6.
Cefalu WT. Pharmacotherapy for the treatment of patients with type 2 diabetes mellitus: Rationale and specific agents. Clin Pharmacol Ther 2007;81:636-49.  Back to cited text no. 6
[PUBMED]    
7.
El-Sisi AE, Hegazy SK, Metwally SS, Wafa AM, Dawood NA. Effect of genetic polymorphisms on the development of secondary failure to sulfonylurea in Egyptian patients with type 2 diabetes. Ther Adv Endocrinol Metab 2011;2:155-64.  Back to cited text no. 7
[PUBMED]    
8.
McTaggart JS, Clark RH, Ashcroft FM. The role of the KATP channel in glucose homeostasis in health and disease: More than meets the islet. J Physiol 2010;588:3201-9.  Back to cited text no. 8
[PUBMED]    
9.
Holden SE, Currie CJ. Mortality risk with sulphonylureas compared to metformin. Diabetes Obes Metab 2014;16:885-90.  Back to cited text no. 9
[PUBMED]    
10.
Phung OJ, Schwartzman E, Allen RW, Engel SS, Rajpathak SN. Sulphonylureas and risk of cardiovascular disease: Systematic review and meta-analysis. Diabet Med 2013;30:1160-71.  Back to cited text no. 10
[PUBMED]    
11.
Monami M, Genovese S, Mannucci E. Cardiovascular safety of sulfonylureas: A meta-analysis of randomized clinical trials. Diabetes Obes Metab 2013;15:938-53.  Back to cited text no. 11
[PUBMED]    
12.
Miller M, Knatterud G, Hawkins BS. A study of the effects of hypoglycemic agents on vascular complications in patients with adult onset diabetes. VI. Supplementary report on nonfatal events in patients treated with tolbutamide. Diabetes 1976;25:1129-53.  Back to cited text no. 12
    
13.
Schroner Z, Javorský M, Halušková J, Klimčáková L, Babjaková E, Fabianová M, et al. Variation in CDKAL1 gene is associated with therapeutic response to sulphonylureas. Physiol Res 2012;61:177-83.  Back to cited text no. 13
    
14.
Diabetes Genetics Initiative of Broad Institute of Harvard and MIT, Lund University, and Novartis Institutes of BioMedical Research, Saxena R, Voight BF, Lyssenko V, Burtt NP, de Bakker PI, et al. Genome-wide association analysis identifies loci for type 2 diabetes and triglyceride levels. Science 2007;316:1331-6.  Back to cited text no. 14
[PUBMED]    
15.
Scott LJ, Mohlke KL, Bonnycastle LL, Willer CJ, Li Y, Duren WL, et al. Agenome-wide association study of type 2 diabetes in Finns detects multiple susceptibility variants. Science 2007;316:1341-5.  Back to cited text no. 15
[PUBMED]    
16.
Steinthorsdottir V, Thorleifsson G, Reynisdottir I, Benediktsson R, Jonsdottir T, Walters GB, et al. Avariant in CDKAL1 influences insulin response and risk of type 2 diabetes. Nat Genet 2007;39:770-5.  Back to cited text no. 16
[PUBMED]    
17.
Zeggini E, Weedon MN, Lindgren CM, Frayling TM, Elliott KS, Lango H, et al. Replication of genome-wide association signals in UK samples reveals risk loci for type 2 diabetes. Science 2007;316:1336-41.  Back to cited text no. 17
[PUBMED]    
18.
Takeuchi F, Serizawa M, Yamamoto K, Fujisawa T, Nakashima E, Ohnaka K, et al. Confirmation of multiple risk Loci and genetic impacts by a genome-wide association study of type 2 diabetes in the Japanese population. Diabetes 2009;58:1690-9.  Back to cited text no. 18
[PUBMED]    
19.
Ohara-Imaizumi M, Yoshida M, Aoyagi K, Saito T, Okamura T, Takenaka H, et al. Deletion of CDKAL1 affects mitochondrial ATP generation and first-phase insulin exocytosis. PLoS One 2010;5:e15553.  Back to cited text no. 19
[PUBMED]    
20.
Dehwah MA, Wang M, Huang QY. CDKAL1 and type 2 diabetes: A global meta-analysis. Genet Mol Res 2010;9:1109-20.  Back to cited text no. 20
[PUBMED]    
21.
Ubeda M, Rukstalis JM, Habener JF. Inhibition of cyclin-dependent kinase 5 activity protects pancreatic beta cells from glucotoxicity. J Biol Chem 2006;281:28858-64.  Back to cited text no. 21
[PUBMED]    
22.
Lew J, Huang QQ, Qi Z, Winkfein RJ, Aebersold R, Hunt T, et al. Abrain-specific activator of cyclin-dependent kinase 5. Nature 1994;371:423-6.  Back to cited text no. 22
[PUBMED]    
23.
Sim X, Ong RT, Suo C, Tay WT, Liu J, Ng DP, et al. Transferability of type 2 diabetes implicated loci in multi-ethnic cohorts from Southeast Asia. PLoS Genet 2011;7:e1001363.  Back to cited text no. 23
[PUBMED]    
24.
Tuerxunyiming M, Mohemaiti P, Wufuer H, Tuheti A. Association of rs7754840 G/C polymorphisms in CDKAL1 with type 2 diabetes: A meta-analysis of 70141 subjects. Int J Clin Exp Med 2015;8:17392-405.  Back to cited text no. 24
[PUBMED]    
25.
Groenewoud MJ, Dekker JM, Fritsche A, Reiling E, Nijpels G, Heine RJ, et al. Variants of CDKAL1 and IGF2BP2 affect first-phase insulin secretion during hyperglycaemic clamps. Diabetologia 2008;51:1659-63.  Back to cited text no. 25
[PUBMED]    
26.
Stancáková A, Pihlajamäki J, Kuusisto J, Stefan N, Fritsche A, Häring H, et al. Single-nucleotide polymorphism rs7754840 of CDKAL1 is associated with impaired insulin secretion in nondiabetic offspring of type 2 diabetic subjects and in a large sample of men with normal glucose tolerance. J Clin Endocrinol Metab 2008;93:1924-30.  Back to cited text no. 26
    
27.
Kirchhoff K, Machicao F, Haupt A, Schäfer SA, Tschritter O, Staiger H, et al. Polymorphisms in the TCF7L2, CDKAL1 and SLC30A8 genes are associated with impaired proinsulin conversion. Diabetologia 2008;51:597-601.  Back to cited text no. 27
    
28.
Palmer ND, Goodarzi MO, Langefeld CD, Ziegler J, Norris JM, Haffner SM, et al. Quantitative trait analysis of type 2 diabetes susceptibility loci identified from whole genome association studies in the Insulin Resistance Atherosclerosis Family Study. Diabetes 2008;57:1093-100.  Back to cited text no. 28
[PUBMED]    
29.
Mansoori Y, Daraei A, Naghizadeh MM, Salehi R. Significance of a common variant in the CDKAL1 gene with susceptibility to type 2 diabetes mellitus in Iranian population. Adv Biomed Res 2015;4:45.  Back to cited text no. 29
[PUBMED]  [Full text]  
30.
Chistiakov DA, Potapov VA, Smetanina SA, Bel'chikova LN, Suplotova LA, Nosikov VV, et al. The carriage of risk variants of CDKAL1 impairs beta-cell function in both diabetic and non-diabetic patients and reduces response to non-sulfonylurea and sulfonylurea agonists of the pancreatic KATP channel. Acta Diabetol 2011;48:227-35.  Back to cited text no. 30
    
31.
Ren Q, Han X, Tang Y, Zhang X, Zou X, Cai X, et al. Search for genetic determinants of sulfonylurea efficacy in type 2 diabetic patients from China. Diabetologia 2014;57:746-53.  Back to cited text no. 31
[PUBMED]    
32.
Intensive blood-glucose control with sulphonylureas or insulin compared with conventional treatment and risk of complications in patients with type 2 diabetes (UKPDS 33). UK prospective diabetes study (UKPDS) group. Lancet 1998;352:837-53.  Back to cited text no. 32
[PUBMED]    
33.
Holman RR, Paul SK, Bethel MA, Matthews DR, Neil HA 10-year follow-up of intensive glucose control in type 2 diabetes. N Engl J Med 2008;359:1577-89.  Back to cited text no. 33
    
34.
Reitman ML, Schadt EE. Pharmacogenetics of metformin response: A step in the path toward personalized medicine. J Clin Invest 2007;117:1226-9.  Back to cited text no. 34
[PUBMED]    
35.
Loganadan NK, Huri HZ, Vethakkan SR, Hussein Z. Genetic markers predicting sulphonylurea treatment outcomes in type 2 diabetes patients: Current evidence and challenges for clinical implementation. Pharmacogenomics J 2016;16:209-19.  Back to cited text no. 35
    
36.
Sehra D, Sehra S, Sehra ST. Sulfonylureas: Do we need to introspect safety again? Expert Opin Drug Saf 2011;10:851-61.  Back to cited text no. 36
[PUBMED]    
37.
Nordin C. The case for hypoglycaemia as a proarrhythmic event: Basic and clinical evidence. Diabetologia 2010;53:1552-61.  Back to cited text no. 37
[PUBMED]    
38.
Holstein A, Egberts EH. Risk of hypoglycaemia with oral antidiabetic agents in patients with type 2 diabetes. Exp Clin Endocrinol Diabetes 2003;111:405-14.  Back to cited text no. 38
[PUBMED]    
39.
Zoungas S, Patel A, Chalmers J, de Galan BE, Li Q, Billot L, et al. Severe hypoglycemia and risks of vascular events and death. N Engl J Med 2010;363:1410-8.  Back to cited text no. 39
[PUBMED]    
40.
Henquin JC. Triggering and amplifying pathways of regulation of insulin secretion by glucose. Diabetes 2000;49:1751-60.  Back to cited text no. 40
[PUBMED]    
41.
Shimajiri Y, Yamana A, Morita S, Furuta H, Furuta M, Sanke T, et al. Kir6.2 E23K polymorphism is related to secondary failure of sulfonylureas in non-obese patients with type 2 diabetes. J Diabetes Investig 2013;4:445-9.  Back to cited text no. 41
    
42.
Osada UN, Sunagawa H, Terauchi Y, Ueda S. A common susceptibility gene for type 2 diabetes is associated with drug response to a DPP-4 inhibitor: Pharmacogenomic cohort in Okinawa Japan. PLoS One 2016;11:e0154821.  Back to cited text no. 42
    



 
 
    Tables

  [Table 1], [Table 2]



 

Top
Previous article  Next article
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
Conclusion
References
Article Tables

 Article Access Statistics
    Viewed281    
    Printed8    
    Emailed0    
    PDF Downloaded43    
    Comments [Add]    

Recommend this journal