Users Online: 964
Home Print this page Email this page
Home About us Editorial board Search Browse articles Submit article Ahead of Print Instructions Subscribe Contacts Login 


 
Previous article Browse articles Next article 
BRIEF REPORT
Adv Biomed Res 2017,  6:43

Evaluation of Energy Balance on Human Telomerase Reverse Transcriptase (hTERT) Alternative Splicing by Semi-quantitative RT-PCR in Human Umbilical Vein Endothelial Cells


1 Heart Failure Research Center, Cardiovascular Research Center, Cardiovascular Research Institute, Isfahan University of Medical Sciences, Isfahan, Iran
2 Department of Cardiology, Isfahan University of Medical Sciences, Isfahan, Iran
3 Department of Genetics and Molecular Biology, Isfahan University of Medical Sciences, Isfahan, Iran
4 Applied Physiology Research Center, Isfahan Cardiovascular Research Institute, Department of Physiology, Isfahan University of Medical Sciences, Isfahan, Iran

Date of Web Publication17-Apr-2017

Correspondence Address:
Mohaddeseh Behjati
Heart Failure Research Center, Cardiovascular Research Center, Cardiovascular Research Institute, Isfahan University of Medical Sciences, Isfahan
Iran
Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.4103/2277-9175.204591

Rights and Permissions
  Abstract 

Background: Decreased high-energy phosphate level is involved in endothelial cell injury and dysfunction. Reduced telomerase activity in endothelial cells in parallel with reduced energy levels might be due to altered direction of alternative splicing machine as a complication of depleted energy during the process of atherosclerosis. Materials and Methods: Isolated human umbilical vein endothelial cells (HUVECs) were treated for 24 hours by oligomycine (OM) and 2-deoxy glucose (2-DG). After 24 hours, the effect of energy depletion on telomerase splicing pattern was evaluated using RT-PCR. Indeed, in both treated and untargeted cells, nitric oxide (NO) and von Willebrand factor (vWF) were measured. Results: ATP was depleted in treated cells by 43.9% compared with control group. We observed a slight decrease in NO levels (P = 0.09) and vWF (P = 0.395) in the setting of 49.36% ATP depletion. In both groups, no telomerase gene expression was seen. Telomerase and housekeeping gene expression were found in positive control group (colon cancer tissue) and sample tissue. Conclusions: The absence of telomerase gene expression in HUVECs might be due to the mortality of these cells or the low level of telomerase gene expression in these cells under normal circumstances.

Keywords: ATP depletion, endothelial cell dysfunction, telomerase, telomere


How to cite this article:
Behjati M, Hashemi M, Kazemi M, Salehi M, Javanmard SH. Evaluation of Energy Balance on Human Telomerase Reverse Transcriptase (hTERT) Alternative Splicing by Semi-quantitative RT-PCR in Human Umbilical Vein Endothelial Cells. Adv Biomed Res 2017;6:43

How to cite this URL:
Behjati M, Hashemi M, Kazemi M, Salehi M, Javanmard SH. Evaluation of Energy Balance on Human Telomerase Reverse Transcriptase (hTERT) Alternative Splicing by Semi-quantitative RT-PCR in Human Umbilical Vein Endothelial Cells. Adv Biomed Res [serial online] 2017 [cited 2020 Jul 9];6:43. Available from: http://www.advbiores.net/text.asp?2017/6/1/43/204591


  Introduction Top


Telomerase is a reverse transcriptase enzyme, which is necessary for proper function of telomeres. It adds TTAGGG repeats to the ends of chromosomes. In this way, it protects terminal ends of chromosomes.[1],[2],[3],[4] Telomerase activity is controlled through various mechanisms, in which alternative splicing is one of them.[5] Alternative splicing is a process in which various proteins are produced from single gene. Among eight alternatively spliced variants of telomerase gene, just full length variant is truly functional.[6] Decreased telomerase activity in endothelial cells is seen in the process of atherosclerosis.[7] This decreased telomerase activity is shown experimentally in regions susceptible to atherosclerosis.[8] The cause of this decrease in telomere length is not well known, however, the theory of telomere shortening is vastly considered during the process of atherogenesis.[9]

Endothelial cell dysfunction is one of the earliest events in the process of atherosclerosis.[10] Indeed, activated endothelial cells pour out UTP, ADP and ATP from themselves. ATP depletion and decrease in energy levels are in parallel with endothelial cell dysfunction.[11],[12],[13] Reduction in adenosine nucleotide level plays an important role in the process of endothelial cell dysfunction.[13],[14] Diminished respiratory rate and ATP synthesis are due to the presence of different stimuli as free fatty acidosis, hypoxia, acidosis, etc.[15],[16] Decreased basic level of nitric oxide (NO) is associated with decreased level of ATP/ADP ratio, which is a marker of impaired recovery of cellular phosphorylation potential.[13],[14],[15],[16],[17],[18] Factors with the ability to maintain endothelial cell function, as 17-beta-hydroxy estrogen, increases efficiency of energy production in endothelial cells.[19] Alternative splicing needs correct regulation, in which its mechanisms are not yet fully understood. Alternative splicing is an energy dependent process and in the setting of appropriate energy levels, incorrect splicing will occur.[20],[21]

Decreased telomerase activity occurs in the process of endothelial cell dysfunction and atherosclerosis. Indeed, decreased ATP/ADP ratio is in parallel with endothelial cell dysfunction and atherosclerosis. Thus, it seems that this telomere dysfunction might be due to decreased energy levels, which could be attributed to impaired alternative splicing. Thus, in this study, we aimed to investigate the role of impaired energy balance on telomerase alternative splicing during the process of endothelial cell dysfunction and atherosclerosis.


  Materials and Methods Top


Isolation of HVECs

Isolated placenta and cord were inserted in cold environment (4°C). Umbilical cord was inserted in a paper towel to get rid from blood and collection medium. A transverse incision was made at terminal end of placenta to determine vein and artery. Then, vein was cannulated after ligation of both terminal ends of vein. Internal lumen of cannula was filled with phosphate-buffer saline (PBS) (in both ends). After dilation of lumen, vein was transferred into incubator (37°C for 10 min). Then, umbilical cord was exited from incubator. Cells were isolated by manual massage and suction. Venus lumen was re-filled with prewarmed PBS. Internal lumen was filled by collagenase solution and cells were centrifugated for 5 min at 1000 rpm. Supernatant was transferred into tissue culture flask T25 with 4 ml of serum including culture medium without growth factor included. The next day, tissue culture medium was removed. Cells were washed using prewarmed serum-free culture medium. Then, 4 ml of tissue culture was added into cells. Cells were feeded with fresh serum plus culture medium. Cells were recultured after removing culture medium from confluent cells. Then, 1 ml of Trypsin-EDTA was added into flask. Flask was transferred into incubator for 5 min. After this stage, equal amounts of culture medium plus growth factor was added to cells. Cells were transferred into incubator and were feeded by changing culture medium every other day. In this study, cells were passaged for three times. Cultured cells were divided into test and control groups. Test cells were treated by oligomycine (OM) and 2-DG for 6 hours.[1] Simultaneous administration of these agents leads to 50% reduction in ATP level without induction of apoptosis.[1]

Endothelial cell characterization

Endothelial cells were characterized using observation of cobble-stone morphology under microscopic evaluation [Figure 1]. Endothelial cells were identified using flow cytometry by anti-CD34 (PECAM) monoclonal antibody.
Figure 1: Photo indicates the presence of telomerase (4120 bp), 100 bp DNA ladder

Click here to view


Nucleotide measurement

ATP/ADP ratio was measured as a marker of endothelial cell dysfunction. Changes in ATP/ADP ratio were measured using measured by bioluminator detection. This kit works based on luciferase enzyme. About 10000 cells were used. Nearly 103-104 (10 μL) of cells were transferred into tissue culture palates after removing culture medium. Next, 100 μL of nucleus releasing buffer was added into cells and cells were incubated in room temperature for 5 min. A total of 1 μL of ATP monitoring enzyme was added into cell lysate and samples were read out in luminator.

Nitric oxide measurement

NO was measured in conditioned medium indirectly using quantification of nitrites by total NO and nitrate/nitrite assay kit per protocol. NO level of both treated and nontreated cells were measured.

Von Willebrand factor measurement

Extracellular von Willebrand factor (vWF) was measured in HUVCs embedded in 96-well plates pre- and post-ATP depletion through Asserachrom vWF kit per protocol (Diagnostica Stago, France).

Expression of telomerase alternative splicing variants after ATP depletion

About 6 hours after induction of ATP depletion, cellular RNA was extracted using RNA extraction kit, per protocol. The following primer pairs were used:[22]

hTERT980S/hTERT1303A, hTERT2164S/hTERT 2620A, hTERT1241S/hTERT1835A, hTERT1783S/hTERT2247A

PCR conditions were as follows:

94°C for 60 seconds

33 cycles of (96°C for 20 seconds, 68°C for 50 seconds, 72°C for 50 seconds)

PCR products were electrophorezed on polyacrylamide gel.

As a positive control, we used a tissue with certain telomerase activity (colon cancer tissue). Beta-actin gene expression was used as a house-keeping gene to verify the accuracy of RNA extraction. Beta-actin primer pairs were as follows:

Forward primer 1 GCACTCTTCCAGCCTTCCTTC 21

Template 862.882

Reverse primer 1 CAGCACTGTGTTGGCGTACA 20

Template 981. 962

Statistical analysis was performed using SPSS version 17.00 by K 2 test.


  Results Top


ATP depletion

ATP was reduced in treated cells by 43.9%. Luminecance change in ATP-depleted cells was 5082.5000 ± 2147.48329 (mean ± SD). In these cells, ATP level was nonsignificantly reduced, which was due to the applied method to avoid cell apoptosis. In control cells, ATP level showed nonsignificant change. In cells of control group, ATP was 22711.5000 ± 7845.34974 (mean ± SD).

ATP depletion and NO release

We observed a slight decrease (16.32%) in NO release between induced and uninduced endothelial cells (7.23 ± 1.13 vs. 8.64 ± 0.85 μm/L, P = 0.09, n = 3). Indeed, our data demonstrated a marginal decrease (15.73%) in secreted vWF between treated and untreated cells (0.0876 ± 0.0087 vs. 0.1056 ± 0.023885 μm/L, P = 0.395, n = 3) [Table 1].[23]
Table 1: Effect of ATP depletion on NO level and vWF secretion of human umbilical vein endothelial cells

Click here to view


Telomerase gene expression

In both groups, no expression of telomerase gene expression was found. Since no telomerase gene expression was found in human umbilical vein endothelial cells (HUVECs), we investigated telomerase gene expression in colon cancer tissue. In this tissue sample, the presence of teloermase gene expression (380 bp) and full length telomerase gene (475 bp) were seen [Figure 2] and [Figure 3]. Other variants were not found in this sample. Expression of beta-actin as a house keeping gene confirmed the accuracy of RNA expression method in our survey [Figure 4].
Figure 2: Cobble-stone morphology of HUVCs

Click here to view
Figure 3: The photo indicates the presence of telomerase (323 bp) using hTERT980S and hTERT1303A Primer pairs (50 bp DNA ladder)

Click here to view
Figure 4: The photo indicates the presence of telomerase (457 bp) using hTERT2164S and hTERT2620A primer pairs (50 bp DNA ladder)

Click here to view



  Discussion Top


Our data implies induced ATP depletion and consequently induced decreased energy level in treated cells. In this setting, NO and vWF factors were measured in which full discussion in values are explained by Behjati et al.[23] In the setting of both ATP depletion and normal energy balance, we observed no telomerase gene expression in HUVECs; thus we used a tissue with certain telomerase gene expression. Full length telomerase gene was found in this tissue. Other variants were negative in this tissue. Expression of beta-actin gene, confirms the accuracy of RNA extraction. These data demonstrate that telomerase gene expression is very low or zero in isolated HUVECs, which is undetectable by RT-PCR. These cells are mortal. In previous studies, immortalized HUVECs using transfected TERT or other vectors were used.[24],[25] In this way, endothelial cell lines were preferred. But since we aimed to evaluate the effect of impaired energy balance on telomerase activity, we were not allowed to use immortal cells. It may be possible that these cells possess very low amounts of telomerase activity, undetectable by RT-PCR. These cells may also have no telomerase activity.

In order to evaluate telomerase gene expression in HUVECs, various methods have been used. Quantitative real time RT-PCR, PCR-based TRAP analysis, linear range of TRAP assay are most often used methods.[26],[27],[28],[29],[30] Some investigators have also used RT-PCR for assessment of telomerase gene expression in HUVECs in instances like assessment of telomerase activity by RT-PCR after induction of TERT over-expression.[31],[32] Indeed, RT-PCR was used to assess telomerase gene expression in HUVECs after administration of agents, which increase telomerase gene expression as 17beta-estradiol. Since both morphology and flow cytometry analysis, confirm the through isolation procedure of endothelial cells, it seems interesting that why telomerase gene expression was evaluated by semi-quantitative RT-PCR by some researchers but with similar applied method, it was undetectable in our survey. So, is semi-quantitative RT-PCR a suitable method for evaluation of telomerase gene expression in HUVECs?


  Conclusions Top


The absence of telomerase gene expression in HUVECs might be due to the mortality of these cells or the low level of telomerase gene expression in these cells under normal circumstances.

Financial support and sponsorship

Nil.

Conflicts of interest

There are no conflicts of interest.

 
  References Top

1.
Kilian A, Bowtell DD, Abud HE, Hime GR, Venter DJ, Keese PK, et al. Isolation of a candidate human telomerase catalytic subunit gene, which reveals complex splicing patterns in different cell types. Hum Mol Genet 1997;6:2011-9.  Back to cited text no. 1
    
2.
Derradji H, Bekaert S, Van Oostveldt P, Baatout S. Comparison of different protocols for telomere length estimation by combination of quantitative fluorescence in situ hybridization (Q-FISH) and flow cytometry in human cancer cell lines. Anticancer Res 2005;25:1039-50.  Back to cited text no. 2
    
3.
Pandita TK, Roti Roti JL. Role of telomerase in radiocurability (review). Oncol Rep 2003;10:263-70.  Back to cited text no. 3
    
4.
Lantuéjoul S, Salon C, Soria JC, Brambilla E. Telomerase expression in lung preneoplasia and neoplasia. Int J Cancer 2007;120:1835-41.  Back to cited text no. 4
    
5.
Liu WJ, Zhang YW, Zhang ZX, Ding J. Alternative splicing of human telomerase reverse transcriptase may not be involved in telomerase regulation during all-trans-retinoic acid-induced HL-60 cell differentiation. J Pharmacol Sci 2004;96:106-14.  Back to cited text no. 5
    
6.
Ulaner GA, Hu JF, Vu TH, Giudice LC, Hoffman AR. Tissue-specific alternate splicing of human telomerase reverse transcriptase (hTERT) influences telomere lengths during human development. Int J Cancer 2001;91:644-9.  Back to cited text no. 6
    
7.
Pu DR, Liu L. HDL slowing down endothelial progenitor cells senescence: A novel anti-atherogenic property of HDL. Med Hypotheses 2008;70:338-42.  Back to cited text no. 7
    
8.
Minamino T, Miyauchi H, Yoshida T, Ishida Y, Yoshida H, Komuro I. Endothelial cell senescence in human atherosclerosis: Role of telomere in endothelial dysfunction. Circulation 2002;105:1541-4.  Back to cited text no. 8
    
9.
Minamino T, Komuro I. Role of telomere in endothelial dysfunction in atherosclerosis. Curr Opin Lipidol 2002;13:537-43.  Back to cited text no. 9
    
10.
Jian W, Arora JS, Oe T, Shuvaev VV, Blair IA. Induction of endothelial cell apoptosis by lipid hydroperoxide-derived bifunctional electrophiles. Free Radic Biol Med 2005;39:1162-76.  Back to cited text no. 10
    
11.
Beldi G, Enjyoji K, Wu Y, Miller L, Banz Y, Sun X, et al. The role of purinergic signaling in the liver and in transplantation: Effects of extracellular nucleotides on hepatic graft vascular injury, rejection and metabolism. Front Biosci 2008;13:2588-603.  Back to cited text no. 11
    
12.
Mathews MT, Berk BC. PARP-1 inhibition prevents oxidative and nitrosative stress-induced endothelial cell death via transactivation of the VEGF receptor 2. Arterioscler Thromb Vasc Biol 2008;28:711-7.  Back to cited text no. 12
    
13.
Carlucci F, Marinello E, Rosi F, Floccari F, Gerunda G, Neri D, et al. Nitric oxide generation is associated with an unbalance of protein tyrosine phosphatases during liver transplantation. Biomed Pharmacother 2007;61:216-21.  Back to cited text no. 13
    
14.
Hurst RD, Azam S, Hurst A, Clark JB. Nitric-oxide-induced inhibition of glyceraldehyde-3-phosphate dehydrogenase may mediate reduced endothelial cell monolayer integrity in an in vitro model blood-brain barrier. Brain Res 2001;894:181-8.  Back to cited text no. 14
    
15.
Hermans MP. Diabetes and the endothelium. Acta Clin Belg 2007;62:97-101.  Back to cited text no. 15
    
16.
Agulló L, Garcia-Dorado D, Escalona N, Inserte J, Ruiz-Meana M, Barrabés JA, et al. Hypoxia and acidosis impair cGMP synthesis in microvascular coronary endothelial cells. Am J Physiol Heart Circ Physiol 2002;283:H917-25.  Back to cited text no. 16
    
17.
de la Torre JC, Stefano GB. Evidence that Alzheimer's disease is a microvascular disorder: The role of constitutive nitric oxide. Brain Res Brain Res Rev 2000;34:119-36.  Back to cited text no. 17
    
18.
Ciapaite J, van Bezu J, van Eikenhorst G, Bakker SJ, Teerlink T, Diamant M, et al. Palmitate and oleate have distinct effects on the inflammatory phenotype of human endothelial cells. Biochim Biophys Acta 2007;1771:147-54.  Back to cited text no. 18
    
19.
Razmara A, Sunday L, Stirone C, Wang XB, Krause DN, Duckles SP, et al. Mitochondrial effects of estrogen are mediated by estrogen receptor alpha in brain endothelial cells. J Pharmacol Exp Ther 2008;325:782-90.  Back to cited text no. 19
    
20.
Krainer AR, Maniatis T, Ruskin B, Green MR. Normal and mutant human beta-globin pre-mRNAs are faithfully and efficiently spliced in vitro. Cell 1984;36:993-1005.  Back to cited text no. 20
    
21.
Hartl DL, Elizabeth W. Genetics: Analysis of Genes and Genomes. Sudbury, Massachusetts: Jones and Bartlett Publishers [My paper] 2005; Jan 1, 2005.  Back to cited text no. 21
    
22.
Ulaner GA, Hu JF, Vu TH, Giudice LC, Hoffman AR. Tissue-specific alternate splicing of human telomerase reverse transcriptase (hTERT) influences telomere lengths during human development. Int J Cancer 2001;91:644-9.  Back to cited text no. 22
    
23.
Behjati M, Hashemi M, Kazemi M, Salehi M. Nitric oxide level and von Willebrand factor (vWF) secretion are not candidate markers of endothelial cell dysfunction in adenosine triphosphate (ATP) depleted endothelial cells. Afr J Biotechnol 2011;10:8871-6.  Back to cited text no. 23
    
24.
Noguchi H, Kobayashi N, Westerman KA, Sakaguchi M, Okitsu T, Totsugawa T, et al. Controlled expansion of human endothelial cell populations by Cre-loxP -based reversible immortalization. Hum Gene Ther 2002;13:321-34.  Back to cited text no. 24
    
25.
Tentori L, Vergati M, Muzi A, Levati L, Ruffini F, Forini O, et al. Generation of an immortalized human endothelial cell line as a model of neovascular proliferating endothelial cells to assess chemosensitivity to anticancer drugs. Int J Oncol 2005;27:525-35.  Back to cited text no. 25
    
26.
Falchetti ML, Mongiardi MP, Fiorenzo P, Petrucci G, Pierconti F, D'Agnano I, et al. Inhibition of telomerase in the endothelial cells disrupts tumor angiogenesis in glioblastoma xenografts. Int J Cancer 2008;122:1236-42.  Back to cited text no. 26
    
27.
Chang H, Rha SY, Jeung HC, Park KH, Kim TS, Kim YB, et al. Telomerase- and angiogenesis -related gene responses to irradiation in human umbilical vein endothelial cells. Int J Mol Med 2013;31:1202-8.  Back to cited text no. 27
    
28.
Ling S, Zhou L, Li H, Dai A, Liu JP, Komesaroff PA, et al. Effects of 17 beta-estradiol on growth and apoptosis in human vascular endothelial cells: Influence of mechanical strain and tumor necrosis factor-alpha. Steroids 2006;71:799-808.  Back to cited text no. 28
    
29.
Vasa M, Breitschopf K, Zeiher AM, Dimmeler S. Nitric oxide activates telomerase and delays endothelial cell senescence. Circ Res 2000;87:540-2.  Back to cited text no. 29
    
30.
Mortuza R, Chen S, Feng B, Sen S, Chakrabarti S. High glucose induced alteration of SIRTs in endothelial cells causes rapid aging in a p300 and FOXO regulated pathway. PLoS One 2013;8:e54514.  Back to cited text no. 30
    
31.
Takano H, Murasawa S, Asahara T. Functional and gene expression analysis of hTERT over expressed endothelial cells. Biologics 2008;2:547-54.  Back to cited text no. 31
    
32.
Ingram DA, Mead LE, Moore DB, Woodard W, Fenoglio A, Yoder MC. Vessel wall-derived endothelial cells rapidly proliferate because they contain a complete hierarchy of endothelial progenitor cells. Blood 2005;105:2783-6.  Back to cited text no. 32
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4]
 
 
    Tables

  [Table 1]


This article has been cited by
1 Telomerase Inhibitors from Natural Products and Their Anticancer Potential
International Journal of Molecular Sciences. 2017; 19(1): 13
[Pubmed] | [DOI]



 

Top
Previous article  Next article
 
  Search
 
Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
Access Statistics
Email Alert *
Add to My List *
* Registration required (free)

 
  In this article
Abstract
Introduction
Materials and Me...
Results
Discussion
Conclusions
References
Article Figures
Article Tables

 Article Access Statistics
    Viewed1402    
    Printed31    
    Emailed0    
    PDF Downloaded174    
    Comments [Add]    
    Cited by others 1    

Recommend this journal